ID: 953135684_953135691

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 953135684 953135691
Species Human (GRCh38) Human (GRCh38)
Location 3:40179843-40179865 3:40179868-40179890
Sequence CCCAAGGTACACCAGGGCCAAGG GTGTCCCTCTTGATACATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128} {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!