ID: 953137359_953137364

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 953137359 953137364
Species Human (GRCh38) Human (GRCh38)
Location 3:40192882-40192904 3:40192921-40192943
Sequence CCATCATGCTTCTACATAGTAAC GAATAAGCTCCTCCCTGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 112} {0: 1, 1: 4, 2: 12, 3: 28, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!