ID: 953192872_953192879

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 953192872 953192879
Species Human (GRCh38) Human (GRCh38)
Location 3:40704988-40705010 3:40705031-40705053
Sequence CCAAGTTATTCAGTTTTGAGACT CTCAAGCTTGCAGCCTATTGTGG
Strand - +
Off-target summary {0: 4, 1: 158, 2: 543, 3: 1088, 4: 1578} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!