ID: 953241815_953241819

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 953241815 953241819
Species Human (GRCh38) Human (GRCh38)
Location 3:41156088-41156110 3:41156128-41156150
Sequence CCGGCAGCTGGTCTGGGCACTGT CCATCCACATTCCACAAAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!