ID: 953243984_953243992

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 953243984 953243992
Species Human (GRCh38) Human (GRCh38)
Location 3:41174553-41174575 3:41174583-41174605
Sequence CCAGGCACAGCTGTCACCCTTGC TTTGCCAGAGTGGAGGCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!