ID: 953246593_953246602

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 953246593 953246602
Species Human (GRCh38) Human (GRCh38)
Location 3:41199385-41199407 3:41199401-41199423
Sequence CCGCCCCCTCGCGCCCCGCCCCT CGCCCCTTGTCCTCGCGCGGCGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 30, 3: 301, 4: 2458} {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!