ID: 953250474_953250478

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 953250474 953250478
Species Human (GRCh38) Human (GRCh38)
Location 3:41242108-41242130 3:41242144-41242166
Sequence CCATTGATCATCAATTAAAAAAA TTAAGGAAAATATCCACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 19, 3: 44, 4: 952} {0: 1, 1: 0, 2: 2, 3: 35, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!