|
Left Crispr |
Right Crispr |
| Crispr ID |
953259335 |
953259341 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:41322394-41322416
|
3:41322417-41322439
|
| Sequence |
CCTTATGCCCCTCAGACAAATTT |
TTCTGAGGAGGCAATAATTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 7, 2: 102, 3: 182, 4: 514} |
{0: 9, 1: 264, 2: 368, 3: 270, 4: 315} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|