ID: 953268500_953268501

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 953268500 953268501
Species Human (GRCh38) Human (GRCh38)
Location 3:41416658-41416680 3:41416673-41416695
Sequence CCACAATAAAATTATTAGGAAAC TAGGAAACACAGCCTGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 556} {0: 1, 1: 0, 2: 1, 3: 11, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!