ID: 953272312_953272321

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 953272312 953272321
Species Human (GRCh38) Human (GRCh38)
Location 3:41457669-41457691 3:41457705-41457727
Sequence CCCTCATGTCAGCCTCCTAACTC CCTTTGTGTGCATCTTGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 434} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!