ID: 953282765_953282775

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 953282765 953282775
Species Human (GRCh38) Human (GRCh38)
Location 3:41574968-41574990 3:41574996-41575018
Sequence CCCAGTTTCTGTCCACAGCCCTG ATTTAAACCCCTGAAAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 287} {0: 1, 1: 0, 2: 0, 3: 18, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!