ID: 953282917_953282921

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 953282917 953282921
Species Human (GRCh38) Human (GRCh38)
Location 3:41575952-41575974 3:41575975-41575997
Sequence CCCTGGCAGTGGAGCCAAAGGGA AGCTGCCAGGAGCAGCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 189} {0: 1, 1: 1, 2: 8, 3: 60, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!