ID: 953282917_953282925

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 953282917 953282925
Species Human (GRCh38) Human (GRCh38)
Location 3:41575952-41575974 3:41575981-41576003
Sequence CCCTGGCAGTGGAGCCAAAGGGA CAGGAGCAGCTCCCTGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 189} {0: 1, 1: 1, 2: 7, 3: 73, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!