ID: 953285151_953285157

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 953285151 953285157
Species Human (GRCh38) Human (GRCh38)
Location 3:41599395-41599417 3:41599411-41599433
Sequence CCCCTTGCCATGTAACCTAAGAT CTAAGATACTCACAGGTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 37, 3: 162, 4: 655} {0: 1, 1: 0, 2: 8, 3: 79, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!