|
Left Crispr |
Right Crispr |
Crispr ID |
953319415 |
953319421 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:41958975-41958997
|
3:41958998-41959020
|
Sequence |
CCCAGCAATTTGGGAGGCCAAGG |
CAGGTAGGTCACCTGAAGTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1150, 1: 92665, 2: 219436, 3: 251336, 4: 265358} |
{0: 1, 1: 90, 2: 2588, 3: 30820, 4: 72098} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|