ID: 953319415_953319421

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 953319415 953319421
Species Human (GRCh38) Human (GRCh38)
Location 3:41958975-41958997 3:41958998-41959020
Sequence CCCAGCAATTTGGGAGGCCAAGG CAGGTAGGTCACCTGAAGTCAGG
Strand - +
Off-target summary {0: 1150, 1: 92665, 2: 219436, 3: 251336, 4: 265358} {0: 1, 1: 90, 2: 2588, 3: 30820, 4: 72098}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!