ID: 953327079_953327083

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 953327079 953327083
Species Human (GRCh38) Human (GRCh38)
Location 3:42021527-42021549 3:42021579-42021601
Sequence CCTGTTTATGACAGGCAGCTTCG CAGTTATTATTTTTTTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 131} {0: 1, 1: 0, 2: 22, 3: 452, 4: 5419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!