ID: 953349785_953349791

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 953349785 953349791
Species Human (GRCh38) Human (GRCh38)
Location 3:42206872-42206894 3:42206887-42206909
Sequence CCATCCTTGGGAGCGGGTGAGGA GGTGAGGAGAGGGAGTGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 182} {0: 1, 1: 0, 2: 11, 3: 125, 4: 1061}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!