ID: 953352011_953352014

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 953352011 953352014
Species Human (GRCh38) Human (GRCh38)
Location 3:42222860-42222882 3:42222873-42222895
Sequence CCCCTGCAGGAAACTGGCCACTG CTGGCCACTGACCCTTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 213} {0: 1, 1: 0, 2: 3, 3: 20, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!