ID: 953357031_953357038

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 953357031 953357038
Species Human (GRCh38) Human (GRCh38)
Location 3:42264817-42264839 3:42264861-42264883
Sequence CCAGTCATGTATTTACCCAACGC CGTGCTCAGAGGGCGGCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37} {0: 1, 1: 0, 2: 1, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!