ID: 953365389_953365400

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 953365389 953365400
Species Human (GRCh38) Human (GRCh38)
Location 3:42340370-42340392 3:42340417-42340439
Sequence CCAACATGGTGGCCTCAGAAAAG GAGAAGGAGGAGAAGGAGGAGGG
Strand - +
Off-target summary No data {0: 7, 1: 77, 2: 663, 3: 2492, 4: 8296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!