ID: 953389705_953389721

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 953389705 953389721
Species Human (GRCh38) Human (GRCh38)
Location 3:42527176-42527198 3:42527216-42527238
Sequence CCACCCCACCCTAAGACACAGTC ACCAGGGCGTTAGGGGTCAGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 33, 4: 298} {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!