ID: 953410028_953410036

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 953410028 953410036
Species Human (GRCh38) Human (GRCh38)
Location 3:42685584-42685606 3:42685606-42685628
Sequence CCTTGGCACCGCCACCGCACCCT TAGGCCACCCACCATGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 244} {0: 1, 1: 0, 2: 1, 3: 6, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!