ID: 953412966_953412975

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 953412966 953412975
Species Human (GRCh38) Human (GRCh38)
Location 3:42700702-42700724 3:42700739-42700761
Sequence CCCGGGGCACAGCCATTACCTTG GGCCCCGGCCAGCATAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 153} {0: 1, 1: 0, 2: 0, 3: 38, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!