ID: 953421318_953421323

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 953421318 953421323
Species Human (GRCh38) Human (GRCh38)
Location 3:42755654-42755676 3:42755701-42755723
Sequence CCAAAACGTGAGAATGAAAATCA CTGGATTTAAGTGGTTTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 241} {0: 1, 1: 0, 2: 2, 3: 27, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!