ID: 953436408_953436424

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 953436408 953436424
Species Human (GRCh38) Human (GRCh38)
Location 3:42881036-42881058 3:42881089-42881111
Sequence CCGGGACAGCCAGAGGGCCCGCG GGCCCCCGAAGCCTCAGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 144} {0: 1, 1: 0, 2: 1, 3: 4, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!