ID: 953458642_953458646

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 953458642 953458646
Species Human (GRCh38) Human (GRCh38)
Location 3:43063722-43063744 3:43063744-43063766
Sequence CCTCCAAAAGGAGTGTTTGGAGA ACTGATAGGAAGACTTAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!