ID: 953464384_953464392

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 953464384 953464392
Species Human (GRCh38) Human (GRCh38)
Location 3:43105991-43106013 3:43106030-43106052
Sequence CCGCCGGGTTCGCAGCGACCGCC GTGTCCGCCGTGCGCCTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 42} {0: 1, 1: 0, 2: 1, 3: 7, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!