ID: 953470798_953470802

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 953470798 953470802
Species Human (GRCh38) Human (GRCh38)
Location 3:43164217-43164239 3:43164244-43164266
Sequence CCTGCAGGAGACACGATCTTGTG AGTCTCCCATGAGCAGGGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!