|
Left Crispr |
Right Crispr |
| Crispr ID |
953503148 |
953503151 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:43457603-43457625
|
3:43457623-43457645
|
| Sequence |
CCTCCCTCAATATGTGGGAATTA |
TTACAATTCAAGATGAGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 82, 2: 1133, 3: 3449, 4: 6024} |
{0: 2206, 1: 9725, 2: 12425, 3: 11533, 4: 7780} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|