|
Left Crispr |
Right Crispr |
| Crispr ID |
953506507 |
953506512 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:43490955-43490977
|
3:43490993-43491015
|
| Sequence |
CCGATAAGATCTCAGGAGTTGGA |
ATGCATATTAAGAGGCAGAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 10, 1: 112, 2: 196, 3: 237, 4: 262} |
{0: 1, 1: 7, 2: 57, 3: 192, 4: 570} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|