ID: 953526025_953526027

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 953526025 953526027
Species Human (GRCh38) Human (GRCh38)
Location 3:43690858-43690880 3:43690872-43690894
Sequence CCGGGCCGTGCTAGTGCGCGGAA TGCGCGGAAGACGCATGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 11} {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!