ID: 953576982_953576988

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 953576982 953576988
Species Human (GRCh38) Human (GRCh38)
Location 3:44120758-44120780 3:44120800-44120822
Sequence CCTTCCTGCTGCTGCTCACACAG GCATACTCTGTTCCCTGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 548} {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!