ID: 953595984_953595986

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 953595984 953595986
Species Human (GRCh38) Human (GRCh38)
Location 3:44314450-44314472 3:44314486-44314508
Sequence CCCAATATGAGGACGCTGAGGTT ACAACAAATAAGTGTAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126} {0: 1, 1: 0, 2: 2, 3: 24, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!