|
Left Crispr |
Right Crispr |
| Crispr ID |
953600358 |
953600362 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:44357125-44357147
|
3:44357152-44357174
|
| Sequence |
CCAGGCATGGTGGCTCATGACTG |
CCCATTGCTTTGAGAGGGTAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 108, 1: 9168, 2: 42140, 3: 105233, 4: 178558} |
{0: 1, 1: 1, 2: 18, 3: 384, 4: 4321} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|