|
Left Crispr |
Right Crispr |
| Crispr ID |
953617683 |
953617690 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:44506797-44506819
|
3:44506834-44506856
|
| Sequence |
CCGTCTCCTGGATTCAAGTGATT |
TTCCAAGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 79, 1: 2045, 2: 19892, 3: 49941, 4: 86213} |
{0: 1904, 1: 54917, 2: 152010, 3: 260731, 4: 534754} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|