|
Left Crispr |
Right Crispr |
| Crispr ID |
953617684 |
953617688 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:44506803-44506825
|
3:44506826-44506848
|
| Sequence |
CCTGGATTCAAGTGATTCTCCAG |
CCTCAGCCTTCCAAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 33, 1: 2577, 2: 43405, 3: 116912, 4: 176264} |
{0: 3527, 1: 101662, 2: 212141, 3: 250946, 4: 264986} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|