ID: 953620912_953620918

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 953620912 953620918
Species Human (GRCh38) Human (GRCh38)
Location 3:44532004-44532026 3:44532033-44532055
Sequence CCAAGCAACTTCAAATTGGTTAA CAACATGGTCTTCCGCAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!