ID: 953626822_953626833

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 953626822 953626833
Species Human (GRCh38) Human (GRCh38)
Location 3:44578885-44578907 3:44578916-44578938
Sequence CCCTCACGGGCGCTCTGCTCCCG CCACCCTCAGCTGGTCCTGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 94} {0: 2, 1: 0, 2: 4, 3: 51, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!