ID: 953628372_953628377

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 953628372 953628377
Species Human (GRCh38) Human (GRCh38)
Location 3:44589706-44589728 3:44589754-44589776
Sequence CCTTTGACCATCAGTTTATATCC ATTCTGGTTGGAATCACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139} {0: 1, 1: 0, 2: 1, 3: 12, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!