ID: 953663156_953663161

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 953663156 953663161
Species Human (GRCh38) Human (GRCh38)
Location 3:44905735-44905757 3:44905755-44905777
Sequence CCACATTTCTCCAAAGATAAGGC GGCATTGCCCTTATAATAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 268} {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!