ID: 953674553_953674559

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 953674553 953674559
Species Human (GRCh38) Human (GRCh38)
Location 3:44990670-44990692 3:44990689-44990711
Sequence CCCATTAGAGACTCAGCACCCAA CCAAGATTTTTACTGGGAGCTGG
Strand - +
Off-target summary {0: 4, 1: 3, 2: 10, 3: 25, 4: 130} {0: 1, 1: 1, 2: 13, 3: 52, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!