ID: 953678381_953678387

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 953678381 953678387
Species Human (GRCh38) Human (GRCh38)
Location 3:45021073-45021095 3:45021094-45021116
Sequence CCCTCCTCAGCGTGGTTCTCCAT ATTGGTCTCCCGTGGTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135} {0: 1, 1: 0, 2: 2, 3: 4, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!