ID: 953678381_953678391

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 953678381 953678391
Species Human (GRCh38) Human (GRCh38)
Location 3:45021073-45021095 3:45021120-45021142
Sequence CCCTCCTCAGCGTGGTTCTCCAT ATATCCAGAGTCTTTTAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135} {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!