ID: 953707118_953707127

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 953707118 953707127
Species Human (GRCh38) Human (GRCh38)
Location 3:45239732-45239754 3:45239777-45239799
Sequence CCTTGGAGGGTTCCAGAAAGCAC GTTTCTGATTCAGCACATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!