ID: 953731374_953731378

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 953731374 953731378
Species Human (GRCh38) Human (GRCh38)
Location 3:45451898-45451920 3:45451941-45451963
Sequence CCTTAGAGATCTTTAACCTTGCT TTATTTGTAACTCTTATAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141} {0: 1, 1: 4, 2: 82, 3: 553, 4: 1772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!