ID: 953731374_953731379

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 953731374 953731379
Species Human (GRCh38) Human (GRCh38)
Location 3:45451898-45451920 3:45451942-45451964
Sequence CCTTAGAGATCTTTAACCTTGCT TATTTGTAACTCTTATAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141} {0: 1, 1: 5, 2: 72, 3: 488, 4: 1596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!