ID: 953751268_953751270

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 953751268 953751270
Species Human (GRCh38) Human (GRCh38)
Location 3:45610274-45610296 3:45610304-45610326
Sequence CCTTTAGCTGGGACACACATTCT ATCCATACCCTACACTGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133} {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!