ID: 953796431_953796438

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 953796431 953796438
Species Human (GRCh38) Human (GRCh38)
Location 3:45989561-45989583 3:45989588-45989610
Sequence CCCAACCCCTTGGACCTATGATT TGTTAACCCACTGCATGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 396} {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!