ID: 953796821_953796828

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 953796821 953796828
Species Human (GRCh38) Human (GRCh38)
Location 3:45992304-45992326 3:45992332-45992354
Sequence CCAGCGTAGGTGCAGAGAGGCAG GGGGCCATGCTGCAGATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 15, 4: 336} {0: 1, 1: 0, 2: 2, 3: 19, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!