ID: 953849013_953849019

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 953849013 953849019
Species Human (GRCh38) Human (GRCh38)
Location 3:46450915-46450937 3:46450951-46450973
Sequence CCGTGCAGCTGCTGCCTGGCAGG ACCAGACCCGTCTGTTTCTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 572} {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!